Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:87 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-19.00 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -9.30 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-16.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGGGCTGTACCGCGCCGTTGGCGGTGAAAACCGCAACCACGCGCGCCCGCAGTTCAC
CGACCATTATTTCACCGGCGATTATCCGACCCGTCTTCTCGACCAGAACGGCGAGGCC
ATGGGCAGCAAGATTTCCATGCTGGCCAGCAACGGCTGAtttttaacaacgacaaagcggccatcggcttc
cggggccgcttttttcttgccttttgttcaggccggtgcgtgcgacgatatgatcgcttgcgaaaggccggcagcgcttcgtagaaggaagcgcaatcat
ttcgggggagaccATG

    AGR_C_1984


Gene: AGR_C_1984     GI: 15888417     BI number: AGR_C_1984     GOG: COG1028     Description: AGR_C_1984


  T
T  T
A  C
G  C
A  A
 AT        aa
 CG       c  c
 GC       a  g
 AT       a  a
 CG       t  c
G  G       ta
 GC        ta
 GC        ta
 TA        tg
A  |      A  |        t
C  |       Gc       c  t
 CG        Tg        gc
 GC        Cg        gc
G  A       Gc        cg
A  A       Gc        tg
 GC       C  a      a  |
 CG       A  t       cg
|  G      A  c       cg
 GC       C  |       gc
 GT       G  |       gc
 CG       A  |       cg
|  A       Cg        gc
 At        Cg        at
 At        Gc        at
 Gt        Gt        at
                        tttcttgccttttgttcaggccggtgcgtgcgacgatatgatcgcttgcgaaaggccggcagcgcttcgtagaaggaagcgcaatcatttcgggggagaccATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[IQR] COG1028 Dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases) ... can be seen here

    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:97 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-19.00 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -9.30 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G=-17.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGGGCTGTACCGCGCCGTTGGCGGTGAAAACCGCAACCACGCGCGCCCGCAGTTCAC
CGACCATTATTTCACCGGCGATTATCCGACCCGTCTTCTCGACCAGAACGGCGAGGCC
ATGGGCAGCAAGATTTCCATGCTGGCCAGCAACGGCTGAtttttaacaacgacaaagcggccatcggcttc
cggggccgcttttttcttgccttttgttcaggccggtgcgtgcgacgatatgatcgcttgcgaaaggccggcagcgcttcgtagaaggaagcgcaatcat
ttcgggggagaccATG

    AGR_C_1984


Gene: AGR_C_1984     GI: 15888417     BI number: AGR_C_1984     GOG: COG1028     Description: AGR_C_1984


  T
T  T
A  C
G  C
A  A
 AT
 CG        ac
 GC       a  a
 AT       t  a
 CG       t  c
G  G      t  g
 GC        ta
 GC        tc
 TA        Aa
A  |       Ga
C  |      T  |        t
 CG        Ca       c  t
 GC        Gg        gc
G  A       Gc        gc
A  A       Cg        cg
 GC        Ag        tg
 CG       A  c      a  |
|  G      C  c       cg
 GC       G  a       cg
 GT       A  |       gc
 CG       C  |       gc
|  A      C  |       cg
 At        Gt        gc
 At        Gc        at
 Gt        Tg        at
 At        Cg        at
                        tttcttgccttttgttcaggccggtgcgtgcgacgatatgatcgcttgcgaaaggccggcagcgcttcgtagaaggaagcgcaatcatttcgggggagaccATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[IQR] COG1028 Dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases) ... can be seen here

    ..................................................................................................................