                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:87 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-19.00 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -9.30 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-16.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGGGCTGTACCGCGCCGTTGGCGGTGAAAACCGCAACCACGCGCGCCCGCAGTTCAC
CGACCATTATTTCACCGGCGATTATCCGACCCGTCTTCTCGACCAGAACGGCGAGGCC
ATGGGCAGCAAGATTTCCATGCTGGCCAGCAACGGCTGAtttttaacaacgacaaagcggccatcggcttc
cggggccgcttttttcttgccttttgttcaggccggtgcgtgcgacgatatgatcgcttgcgaaaggccggcagcgcttcgtagaaggaagcgcaatcat
ttcgggggagaccATG

    AGR_C_1984 Gene: AGR_C_1984     GI: 15888417     BI number: AGR_C_1984     GOG: COG1028     Description: AGR_C_1984   T T  T A  C G  C A  A AT        aa CG       c  c GC       a  g AT       a  a CG       t  c G  G       ta GC        ta GC        ta TA        tg A  |      A  |        t C  |       Gc       c  t CG        Tg        gc GC        Cg        gc G  A       Gc        cg A  A       Gc        tg GC       C  a      a  | CG       A  t       cg |  G      A  c       cg GC       C  |       gc GT       G  |       gc CG       A  |       cg |  A       Cg        gc At        Cg        at At        Gc        at Gt        Gt        at                         tttcttgccttttgttcaggccggtgcgtgcgacgatatgatcgcttgcgaaaggccggcagcgcttcgtagaaggaagcgcaatcatttcgggggagaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IQR] COG1028 Dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases) ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:97 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-19.00 kcal/mol Antiterminator: Size=46 nt.     Delta G= -9.30 kcal/mol Anti-antiterminator:   Size=57 nt.     Delta G=-17.40 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ACGGGCTGTACCGCGCCGTTGGCGGTGAAAACCGCAACCACGCGCGCCCGCAGTTCAC CGACCATTATTTCACCGGCGATTATCCGACCCGTCTTCTCGACCAGAACGGCGAGGCC ATGGGCAGCAAGATTTCCATGCTGGCCAGCAACGGCTGAtttttaacaacgacaaagcggccatcggcttc cggggccgcttttttcttgccttttgttcaggccggtgcgtgcgacgatatgatcgcttgcgaaaggccggcagcgcttcgtagaaggaagcgcaatcat ttcgggggagaccATG     AGR_C_1984 Gene: AGR_C_1984     GI: 15888417     BI number: AGR_C_1984     GOG: COG1028     Description: AGR_C_1984   T T  T A  C G  C A  A AT CG        ac GC       a  a AT       t  a CG       t  c G  G      t  g GC        ta GC        tc TA        Aa A  |       Ga C  |      T  |        t CG        Ca       c  t GC        Gg        gc G  A       Gc        gc A  A       Cg        cg GC        Ag        tg CG       A  c      a  | |  G      C  c       cg GC       G  a       cg GT       A  |       gc CG       C  |       gc |  A      C  |       cg At        Gt        gc At        Gc        at Gt        Tg        at At        Cg        at                         tttcttgccttttgttcaggccggtgcgtgcgacgatatgatcgcttgcgaaaggccggcagcgcttcgtagaaggaagcgcaatcatttcgggggagaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IQR] COG1028 Dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases) ... can be seen here     ..................................................................................................................