                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:120 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-16.40 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-15.60 kcal/mol
Anti-antiterminator:   Size=22 nt.     Delta G= -6.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgaactggtcatggctttcgaagaagaattcggcgttgaaattcccgacgacgcagctgactcgatcctgactgtcggcgacgccgtcaagttcatcgag
aaggcccaggcctgatcgaccttcatcgggaaggtgacatatcttcccgtcttggcccggcttgtccgggccaatgttttataggcagccggtacgtgcc
ccgaagggtgtgcgttcccgatgtcgcaatgggtcacgggccgcgacggcgctgcctgtaaccttcatacaaagattagacatactgcagcctgctgtgc
GTG

    AGR_C_2030 --- AGR_C_2032 --- AGR_C_2034 Gene: AGR_C_2030     GI: 15888437     BI number: AGR_C_2030     GOG: COG0304     Description: AGR_C_2030p Gene: AGR_C_2032     GI: 15888438     BI number: AGR_C_2032     GOG: -------     Description: AGR_C_2032p Gene: AGR_C_2034     GI: 15888439     BI number: AGR_C_2034     GOG: COG1559     Description: AGR_C_2034             c           a  a            gt            ta            gt            gc            at            at            gc            gc            gc            cg   c       t  t        t t  g      a  c      t  g a  g      c  t      c  t cg       t  t       gc ta       t  |       gc ta        cg        cg cg        cg        cg cg       |  c       cg at       a  c       gc g  |       gc        gc cg        cg        ta ta        tg        ta                         tgttttataggcagccggtacgtgccccgaagggtgtgcgttcccgatgtcgcaatgggtcacgggccgcgacggcgctgcctgtaaccttcatacaaagattagacatactgcagcctgctgtgcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IQ] COG0304 3-oxoacyl-(acyl-carrier-protein) synthase ... can be seen here [R] COG1559 Predicted periplasmic solute-binding protein ... can be seen here     ..................................................................................................................