                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:96 nt.    Distance to gene:3 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -7.00 kcal/mol
Antiterminator:    Distance from promoter:68 nt. Size=38 nt.     Delta G= -6.60 kcal/mol
Anti-antiterminator:    Distance from promoter:33 nt.    Size=54 nt.     Delta G=-18.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttattg-tatatt. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttattgttttataagtttgtttttatattggtttctttaggcgggtggggcgcgtgagggttttatttccggctcgctgttcgagtggcatgggccaacg
gggcgaatggtggtaatcttatactttccctgcgtagcagtgggatttttgaTTG

    AGR_C_2062 Gene: AGR_C_2062     GI: 15888453     BI number: AGR_C_2062     GOG: COG2199,COG2200     Description: AGR_C_2062 tg a  g cg gc gc ta g  a a  | gc         t cg       a  c tg       a  t t  |      t  t g  |      g  a tg        gt cg        ta gc        gc cg        gt ta       t  | c  a       at         t g  |       at       g  a gt        gc        cg cg       c  |       gc cg        gc        ta t  t       gc        cg t  g       gt       |  t tg       |  g       cg at        gc        cg ta        cg        tg ta        at        ta                         tttttgaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG2199 FOG: GGDEF domain ... can be seen here [T] COG2200 FOG: EAL domain ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:86 nt.    Distance to gene:86 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -8.30 kcal/mol Antiterminator:    Distance from promoter:20 nt. Size=74 nt.     Delta G=-15.00 kcal/mol Anti-antiterminator:   Size=64 nt.     Delta G= -9.70 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttcaca-tatttt. It has a score value of 60.24 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttcacaagtattgttgttaacgtttatttttgtcgttgccctagtgcaatcttaaatgataagtttaaagacgaatttttgaattattgttttataagtt tgtttttatattggtttctttaggcgggtggggcgcgtgagggttttatttccggctcgctgttcgagtggcatgggccaacggggcgaatggtggtaat cttatactttccctgcgtagcagtgggatttttgaTTG     AGR_C_2062 Gene: AGR_C_2062     GI: 15888453     BI number: AGR_C_2062     GOG: COG2199,COG2200     Description: AGR_C_2062             t           a  t           t  g           t  t            at ta        at c  g       gt c  t       ta cg       t  t gc        ta ta        ta ta        tg gt        at c  c       at t  t       gt g  t       cg t  |       at t  |       gt ta        at ta        at ta        at at        ta tg       t  t ta        ta |  t       gt t  a       at         g g  a      |  g      t  g cg       |  g      g  g at       a  t      g  g at       t  t       gc |  t       at        cg t  a       gc        gc t  a      t  |      g  g g  a       at        at tg        at        tg ta        at        ta gc        ta        tg tg        tg        cg ta        cg        tg                         ttttatttccggctcgctgttcgagtggcatgggccaacggggcgaatggtggtaatcttatactttccctgcgtagcagtgggatttttgaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG2199 FOG: GGDEF domain ... can be seen here [T] COG2200 FOG: EAL domain ... can be seen here     ..................................................................................................................