                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:208 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G= -9.80 kcal/mol
Antiterminator: Size=23 nt.     Delta G=-13.20 kcal/mol
Anti-antiterminator:   Size=19 nt.     Delta G= -6.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATTGATATCGACCTCCAGCGCGCAGGCGCTCGGACAGTCATGCGGGCAGACCGTATG
GCCAATACGGACTTCGGCCTTGGAGGCGGCTTTTTCAGCGGAAATCGGGGTCGCAACG
TTCATGTCTTTTGTATATTGCATCAACGATGCGGCAAAAAGGCCGAAGTGACGTCCAT
CAAGAATATTCATCCTGACCATtcatcccgataaacgccaagcgagacacatccatgaactaccgccacatctatcacgccggc
aatttcgcggatgtcctcaaacatgccgttctcgcccgcctcGTG

    AGR_C_2101 Gene: AGR_C_2101     GI: 15888472     BI number: AGR_C_2101     GOG: COG2961     Description: AGR_C_2101                      GG                     C  A                     A  C                     T  T                     A  T                     A  C                      CG                      CG             A        GC           C  G       GC TC       G  A      |  T G  A       GC       |  T G  T       GC       |  G TG        CG       |  G GC        GT       T  A cG        TA       A  G t  |       AT        TG cG        CG        GC cG        TG        CG gC        GC        CG                         CTTTTTCAGCGGAAATCGGGGTCGCAACGTTCATGTCTTTTGTATATTGCATCAACGATGCGGCAAAAAGGCCGAAGTGACGTCCATCAAGAATATTCATCCTGACCATtcatcccgataaacgccaagcgagacacatccatgaactaccgccacatctatcacgccggcaatttcgcggatgtcctcaaacatgccgttctcgcccgcctcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG2961 Protein involved in catabolism of external DNA ... can be seen here     ..................................................................................................................