                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:195 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-13.50 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -7.70 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G=-11.76 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTATTCCTGGTCGCTTTCTGGCTGGATCACCGCCAAAATGAAGAGCGCGCAAGAATTG
ATTTACCATAAgaataaagcaattcggcctgttttcaggccggtttttccgcttaagtcattgatttataatgtactggctctgagcattcc
cgcttcgccacaagttcggcgccttcgggaaaatgtaggcaaccatttgttaatcgtagcttttaagtagaattttatgcgcattgattaggttctcact
caaggcgggagacaaacaaacacaccgccaaacaaaacagtgaggcagtcATG

    AGR_C_2152 Gene: AGR_C_2152     GI: 15888501     BI number: AGR_C_2152     GOG: COG1846     Description: AGR_C_2152 TC A  A GC GC T  | CG GC GC TA |  A |  A |  A |  T CG TA |  A        A TG       T  A TA       A  g CG       C  a GC       C  a CG        At |  C       Ta |  G       Ta |  C       Ta |  A      A  g |  A       Gc |  G       Ta |  A       Ta |  A       At |  T       At |  T       Gc        tt |  G      A  g      t  t |  A      A  |       gc |  T       Cg        ta |  T       Gc        cg |  T      C  c       cg TA        Gt        gc GC        Cg        gc GC        Gt        cg TA        At        tg                         tttttccgcttaagtcattgatttataatgtactggctctgagcattcccgcttcgccacaagttcggcgccttcgggaaaatgtaggcaaccatttgttaatcgtagcttttaagtagaattttatgcgcattgattaggttctcactcaaggcgggagacaaacaaacacaccgccaaacaaaacagtgaggcagtcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1846 Transcriptional regulators ... can be seen here     ..................................................................................................................