                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:156 nt.     Distance to run of Ts=2 nt.   Size=25 nt.     Delta G= -8.10 kcal/mol
Antiterminator: Size=27 nt.     Delta G= -7.50 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G=-17.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGGACGGCGTAGTTCAGTTCCGCGACGATATCTACGGCAAGGACGGCAACGCCGAAC
TGGCGCTCAACACCACCGCGGGCATGGAGCAGCCGGCAGGTGCGGTGGACGACGATCT
CTTGCCGCGCAACTGAtcgggctttttgccgtcagcgtggaattgtgggcgaggggacaggtgatcgctggaaagccggccagtccct
ccgccgtcatcctcgggcttgtcccgaggatctaatcacctatcgtaaaatagaagcgttgcagatccttgggacaagcccgaggatgacgcgagtGTG

    AGR_C_2156 --- AGR_C_2157 --- AGR_C_2159 --- AGR_C_2161 Gene: AGR_C_2156     GI: 15888503     BI number: AGR_C_2156     GOG: COG0112     Description: AGR_C_2156p Gene: AGR_C_2157     GI: 15888504     BI number: AGR_C_2157     GOG: COG1327     Description: AGR_C_2157p Gene: AGR_C_2159     GI: 15888505     BI number: AGR_C_2159     GOG: COG0117,COG1985     Description: AGR_C_2159p Gene: AGR_C_2161     GI: 15888506     BI number: AGR_C_2161     GOG: COG0307     Description: AGR_C_2161   C G  A A  G GC GC TG A  |       CG CG       A  A        G GC       G  T      C  C |  A      C  C       CG |  G       AT        GC G  G       GC        TA GT       |  T       TA CG        GT       C  C GC        TG       T  T CG        GC        CG CG        GC        TA AT        CG        At CG        GC        Gc CG        TG        Cg                         ggctttttgccgtcagcgtggaattgtgggcgaggggacaggtgatcgctggaaagccggccagtccctccgccgtcatcctcgggcttgtcccgaggatctaatcacctatcgtaaaatagaagcgttgcagatccttgggacaagcccgaggatgacgcgagtGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0112 Glycine/serine hydroxymethyltransferase ... can be seen here [K] COG1327 Predicted transcriptional regulator, consists of a Zn-ribbon and ATP-cone domains ... can be seen here [H] COG0117 Pyrimidine deaminase ... can be seen here [H] COG1985 Pyrimidine reductase, riboflavin biosynthesis ... can be seen here [H] COG0307 Riboflavin synthase alpha chain ... can be seen here     ..................................................................................................................