Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:97 nt.     Distance to run of Ts=3 nt.   Size=21 nt.     Delta G=-10.10 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-10.00 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-18.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gctggaccagctccccgagcgtgtacgggaggtctcccctacgcttcgcggccttctcacccatgtcgatcggttcgcccctgatgagcttcgccttact
gtcgagttcccaaagttctgcttcgctttctgttgcgaagctgcggcggtgccgagcgcctttatgagttacggttccttcccaagaggaaccacgtttc
ttcgccatttagctctccttcaagttgacatgggaatgcatccggcataccgagaagcagccgcccgcatggtgaaattggtaaacacatcgcacttaaa
ATG

    AGR_C_2200


Gene: AGR_C_2200     GI: 15888530     BI number: AGR_C_2200     GOG: -------     Description: AGR_C_2200


 ct
t  g
t  t
t  t
 cg
 gc
 cg        tt
 ta       t  a
 ta       c  t
 cg       c  g
 gc       g  a
t  t       cg
c  |       gt
t  |       at
 tg       |  a
 gc        gc
a  g       cg
a  g       cg
a  c       gt         c
c  |      t  t      c  a
 cg        gc       c  a
 cg        gc        tg
t  t      |  t       ta
 tg       c  t       cg
 gc        gc        cg
a  |       gc        ta
 gc       c  |       ta
 cg        gc        gc
 ta        ta        gc
                        acgtttcttcgccatttagctctccttcaagttgacatgggaatgcatccggcataccgagaagcagccgcccgcatggtgaaattggtaaacacatcgcacttaaaATG


    ..................................................................................................................