                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:90 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G= -6.30 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -9.20 kcal/mol
Anti-antiterminator:   Size=17 nt.     Delta G= -3.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCAATATCAGCCTTGGTCTGTTCATTCTTTCGGCCATCGTCGCACGCGGCGCGCGCT
TTTTCATCCTCGCCGGATTGCTGCAGCGATACGGGGAATCGGTGCGCCACTTCATTGA
AAAACGTCTCGGTGCCATAACGGCCGCGGCGGCTGCCGCACTCATCGCGATTTATGCG
GTTTACGTTTTCGTGCGTTGAtcaaacgcaattttttcactcttacaatactgtcgcatatctttcagcttactgtcagaatcta
catgtatccgttctctcgtccaatgagggaaccgttttattATG

    AGR_C_2266 Gene: AGR_C_2266     GI: 15888562     BI number: AGR_C_2266     GOG: COG2365     Description: AGR_C_2266             T           T  T           G  A            GC            CG            GT           T  T           A  T           T  T           T  C           T  G   T       A  |        t T  T       GT       A  c A  A       CG       G  a GT        GC        Ta CG        CG        Ta GC       T  T       Gc CG        AT        Cg TG        CG        Gc AT        TA        Ta                         attttttcactcttacaatactgtcgcatatctttcagcttactgtcagaatctacatgtatccgttctctcgtccaatgagggaaccgttttattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG2365 Protein tyrosine/serine phosphatase ... can be seen here     ..................................................................................................................