Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:43 nt.     Distance to run of Ts=3 nt.   Size=24 nt.     Delta G=-10.80 kcal/mol
Antiterminator: Size=74 nt.     Delta G=-23.43 kcal/mol
Anti-antiterminator:   Size=25 nt.     Delta G= -8.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCTCAGATCACTCATCGGCACCGTCGTCATTATCTGCCTCGTCGTCATTTATGCCGT
CGCGGCGACGGCCATTGCATCGGCGACGCTGGCGCAATCGCCGTGGTGGGTGCATCTC
GCCTATTTCGTGCTGAGCGGGGTCCTGTGGATCCTGCCGGCGATGCTGATCATCAAAT
GGATGGCCGGTTCAAAAAAACAGGGCTAAgcgcagtcggctacaggacaccctgaggtcgcaattttataaacagattg
tttgccgctcaacgatatagtccgaccgaaacaaccggagagagtggATG

    AGR_C_2285


Gene: AGR_C_2285     GI: 15888571     BI number: AGR_C_2285     GOG: COG5653     Description: AGR_C_2285


           AA
          A  A
          C  A
           TA
           TA
           GC
          |  A
          G  G
           CG
           CG
           GC
           GT
           TA
          A  |
          G  |
          G  |
          T  |
          A  |
          A  |
          A  |
          C  |
          T  |
          A  |
          C  |
          T  |
          A  |
          G  |
           TA
           Cg
           Gc
           Tg
          A  c
          G  a
  A        Cg
A  T       Gt        ca
A  G       Gc       a  c
 CG        Cg        gc
 TA        Cg        gc
 AT        Gc        at
 CG       |  t       cg
T  G      |  a      a  a
A  C      |  c       tg
 GC        Ta        cg
 TG        Cg        gt
 CG        Cg        gc
 GT        Ta        cg
                        caattttataaacagattgtttgccgctcaacgatatagtccgaccgaaacaaccggagagagtggATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[M] COG5653 Protein involved in cellulose biosynthesis (CelD) ... can be seen here

    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:56 nt.     Distance to run of Ts=3 nt.   Size=24 nt.     Delta G=-10.80 kcal/mol
Antiterminator: Size=74 nt.     Delta G=-23.43 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-10.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCTCAGATCACTCATCGGCACCGTCGTCATTATCTGCCTCGTCGTCATTTATGCCGT
CGCGGCGACGGCCATTGCATCGGCGACGCTGGCGCAATCGCCGTGGTGGGTGCATCTC
GCCTATTTCGTGCTGAGCGGGGTCCTGTGGATCCTGCCGGCGATGCTGATCATCAAAT
GGATGGCCGGTTCAAAAAAACAGGGCTAAgcgcagtcggctacaggacaccctgaggtcgcaattttataaacagattg
tttgccgctcaacgatatagtccgaccgaaacaaccggagagagtggATG

    AGR_C_2285


Gene: AGR_C_2285     GI: 15888571     BI number: AGR_C_2285     GOG: COG5653     Description: AGR_C_2285


           ac
          t  a
          c  g
           gg
           ga
           cc
          |  a
          t  c
           g
           a
           c
           g
           c
          g  |
          A  |
          A  |
 AA       T  |
A  A      C  |
C  A      G  |
 TA       G  |
 TA       G  |
 GC       A  |
|  A      C  |
G  G      A  |
 CG       A  |
 CG       A  |
 GC       A  |
 GT        A
 TA        A
A  A       A
G  g       C
 Gc       T
 Tg       T
A  c       G
A  a       G        ca
A  |       C       a  c
C  |       C        gc
T  |       G        gc
A  |       G        at
C  |      |         cg
 Tg       |        a  a
 At       |         tg
 Gc        T        cg
 Tg        A        gt
 Cg        G        gc
 Gc        G        cg
                        caattttataaacagattgtttgccgctcaacgatatagtccgaccgaaacaaccggagagagtggATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[M] COG5653 Protein involved in cellulose biosynthesis (CelD) ... can be seen here

    ..................................................................................................................