                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:71 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-20.20 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-10.00 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-10.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCCGGTGCCGTTCGTCACGGTGTTTCCAAGGCTCTCACCTACTTCGAACCGGGCCTG
CGCCCCGTTCTGAAGAAGGGTGGCTTCCTGACCCGCGACAGCCGCGTTGTCGAGCGTA
AGAAGTACGGTAAGGCCAAGGCCCGCCGTTCGTTCCAGTTCTCCAAGCGTTAAtcgcttat
cggaacagttcgatcagaacttcaaaaggcggggcttcggctccgccttttttcatgacccttctcccttgttttttcggcgagaaggcagcaccttcag
cgcaaaacgcgatggggtgacatATG

    AGR_C_2296 Gene: AGR_C_2296     GI: 15888576     BI number: AGR_C_2296     GOG: COG0010     Description: AGR_C_2296   A T  A T  t        t Gc       a  c Cg       g  a Gc        cg At        ta At        ta |  a       gc C  t       at C  c      c  | Tg       a  | Cg        at Ta        gc        tc Ta       g  a      t  g Gc       c  a       cg A  a      t  a       gc C  g      a  |       gt C  t       ta        gc T  t       tg        gc T  |       cg        cg Gc        gc        gc Cg        cg        gc Ta        tg        at                         tttttcatgacccttctcccttgttttttcggcgagaaggcagcaccttcagcgcaaaacgcgatggggtgacatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0010 Arginase/agmatinase/formimionoglutamate hydrolase, arginase family ... can be seen here     ..................................................................................................................