                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:183 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-12.30 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-10.10 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G= -7.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttaaaaactggacagaaatagtcaataaaatccgaattcccgtgtttggtgaaatcattttgcgtggacaaaaagcgaccgctgcaggacgatgaactt
tccgtggcagcgatttttggccgggcaggggttcaagagaacggagaggcttcctagatgggaagggtgggcgcaatcgccggcgtcagggatgtgttcg
cgaaatcatgcaggagacgctatcctggcggggctttcggatggcgaacttgcgctggcattcttcaaaccaggtgacgttccagaagggataagttgac
ATG

    AGR_C_2308 Gene: AGR_C_2308     GI: 15888580     BI number: AGR_C_2308     GOG: COG1832     Description: AGR_C_2308 gt t  t gt cg cg |  t cg         a ta       a  a ta       a  g a  a      a  c at       c  g       ga gc       a  a      t  a c  |       gc       a  c c  |       gc       g  t ta        tg       c  t at        gc        at at       |  t       gc at        cg        gc at        gc       |  g tg        ta       |  t |  c       tg       a  g |  g       tg        cg a  t       ta        gc a  g      a  c       ta cg        cg        cg ta        ta        gc gc        at        cg                         atttttggccgggcaggggttcaagagaacggagaggcttcctagatgggaagggtgggcgcaatcgccggcgtcagggatgtgttcgcgaaatcatgcaggagacgctatcctggcggggctttcggatggcgaacttgcgctggcattcttcaaaccaggtgacgttccagaagggataagttgacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1832 Predicted CoA-binding protein ... can be seen here     ..................................................................................................................