                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:170 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-10.60 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -5.90 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G= -7.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGAATTGAggcgcgccgctctctgacgtttgtttgactccgcaaaagtaatttcggggctttcaaccgcaacagaaagcgatattagtatata
taaaggctatgttgagtttttatgacgtagccttgtttgatggggaattcgttgcagccggtggtcagctcatgtatctgataccggttagtaccccggg
aaacgaggcggatacggcgatgcaccccaaggcgagccgtatcggcgggcggtaagttgaccgcgatccgtttggcggacctgcggcgtgctggaaggaa
agtgatATG

    AGR_C_2327 Gene: AGR_C_2327     GI: 15888589     BI number: AGR_C_2327     GOG: COG1219     Description: AGR_C_2327            gt ta       a  a g  a      t  t at        ta at        at at        ta a  |       at c  |      |  a gc       |  a cg       |  a cg       g  g tg        cg cg        gc        tt |  c       at       t  t |  t      a  a      g  t |  t      a  |      a  a at       g  |      g  t gc        at        tg ta        cg        ta ta        at        gc |  c       at        tg |  c       cg        at tg       g  a       ta gc       c  |       cg ta        cg        gc ta        at        gc                         ttgtttgatggggaattcgttgcagccggtggtcagctcatgtatctgataccggttagtaccccgggaaacgaggcggatacggcgatgcaccccaaggcgagccgtatcggcgggcggtaagttgaccgcgatccgtttggcggacctgcggcgtgctggaaggaaagtgatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG1219 ATP-dependent protease Clp, ATPase subunit ... can be seen here     ..................................................................................................................