                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:156 nt.     Distance to run of Ts=1 nt.   Size=31 nt.     Delta G=-10.10 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-16.80 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-11.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ggagcggattgcgctttgctgataaagtcttacaactgatttgcagcgcgatatgacggaaatgtgaattaccgtcggcgacccggttcctggccttcaa
ggataaccggaaatgtcgggagtatagccggcgctgggttttgttgaatttcacggttctgccggtgcgcgggaccgtctcttccggcgacttgaaatcg
gtgtttcgaaactccactttcagtctcgagaaatgaatgtgccggatgcccccaagatgtccggcaaagtgtcccgaaagggaccaggaaaggaaatgat
ATG

    AGR_C_2329 Gene: AGR_C_2329     GI: 15888590     BI number: AGR_C_2329     GOG: COG0466     Description: AGR_C_2329 tg g  a ta at at        ct a  a      c  t gc       g  c gc       g  a cg        ta at        cg gc        cg tg        ta        ta a  |      |  t      g  t t  |      |  a      a  a a  |       ta       g  g g  |       gc        gc cg        gc        gc gc        cg        cg cg        cg        tg g  a      |  a       gc a  c      c  a      t  g c  c      a  a      a  | gc        gt       a  | tg        cg       a  | tg        gt        gc t  t       gc        gt at        cg        cg gc        tg        cg                         gttttgttgaatttcacggttctgccggtgcgcgggaccgtctcttccggcgacttgaaatcggtgtttcgaaactccactttcagtctcgagaaatgaatgtgccggatgcccccaagatgtccggcaaagtgtcccgaaagggaccaggaaaggaaatgatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0466 ATP-dependent Lon protease, bacterial type ... can be seen here     ..................................................................................................................