                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:58 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-18.80 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -8.80 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-21.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGATGTCCGGCGGCGGGCATGCGGCTTTTTCAGGCTCACGAGGAAACATGTTTTGACG
CGCTCATGCCATTATCAGGTGTGAGGTGGCCTTCGAAAGCTCTTTCGGGCGGCCCGGT
TTCACCCCTTATGGTGTGGATTGAAAGTCTCGAGGCGCCTGTGTAGcttccattcggacacacggc
gtttcgaaaagcggaatgtgcgcataaacacgaaagcccggcctccatggccgggctttttgattctccgccataaaatgtcatgccactgtcacgtctt
tgacgcagaagccatgggGTG

    AGR_C_2334 Gene: AGR_C_2334     GI: 15888593     BI number: AGR_C_2334     GOG: NOG05087     Description: AGR_C_2334 tt a  c        t cg       a  g cg       a  t ta       g  g t  c       gc c  |       cg G  |       gc A  |      |  a Ta       |  t Gc       |  a Ta       a  a Gc       a  a T  |      a  c        c Cg       a  a      c  a Cg        gc       t  t Gc        cg        cg Cg        ta        cg Gt        ta        gc Gt        ta        gc At       g  |       cg Gc        cg        cg Cg        gc        cg Ta        gc        gc                         tttttgattctccgccataaaatgtcatgccactgtcacgtctttgacgcagaagccatgggGTG     ..................................................................................................................