                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:74 nt.     Distance to run of Ts=2 nt.   Size=28 nt.     Delta G=-17.80 kcal/mol
Antiterminator: Size=58 nt.     Delta G=-15.77 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G=-13.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGACGACCGTGCAGGCCAGAAATTCGCCACAGCCGATCTGATCGGTGTGCCGGTGCA
GATCATCGTCGGCCCGCGTTCTGTTGCGAACGGCGAAGTCGAAGTGAAGGACCGCAAG
ACCGGCGAACGTGAAACCGTCACAATCGAGGCGGCAATGAACAAGGCGCTTGGCTAAg
cgcaaagggaaagatgggagcggccttcatgcgaagaccgctccggttttatggcgcaggcgctgctacgattgggaccgatctttggaaaagaccgatc
ctgcaaattgagatcagggagacgacATG

    AGR_C_2376 --- AGR_C_2377 Gene: AGR_C_2376     GI: 15888617     BI number: AGR_C_2376     GOG: COG4591     Description: AGR_C_2376p Gene: AGR_C_2377     GI: 15888618     BI number: AGR_C_2377     GOG: COG1136     Description: AGR_C_2377            GC AT       G  T A  C       TA C  G       TA A  A       Cg CG        Gc TG        Cg GC        Gc CG       |  a CG       |  a |  C      |  a |  A      |  g A  A      |  g A  T      |  g A  G      G  a G  A      A  a TA       A  a GC       C  g |  A      A  a       tg C  A      A  t      a  c A  G      G  g       cg A  G      T  g       ta GC       A  g       ta CG       A  a       cg GC        Cg       c  a |  T       Gc        gc GT       G  g       gc CG        Cg        cg CG        Gc        gc A  |       Gc        at GC        At        gc AT        Gt        gc                         ggttttatggcgcaggcgctgctacgattgggaccgatctttggaaaagaccgatcctgcaaattgagatcagggagacgacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG4591 ABC-type transport system, involved in lipoprotein release, permease component ... can be seen here [V] COG1136 ABC-type antimicrobial peptide transport system, ATPase component ... can be seen here     ..................................................................................................................