                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:166 nt.     Distance to run of Ts=1 nt.   Size=26 nt.     Delta G= -8.10 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -5.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGAGGGAATACGTATCCGCGATATCCGCATTTCCGCCATCGATGACCATCATTGTATT
GCGCATGTGTCCTGGACAGCGAACTTTACCCGAAAAGGCCAATCGAATGTCGCAATCG
ATTTCGACGTTCATTATTTCGTTCAGACACTGGATGGCGAACCGAAGGTTTTCGGCTG
GGTATCGGGTGACGAGCAGGCGCTCCTGAAGGAACACGGTATTGCCTGAcggtccagaacgatg
gacaccatctttgccggattgaggaaacagcaccgtgttttcatttcagcggttgcaggcgcTTG

    AGR_C_2407 --- AGR_C_2404 Gene: AGR_C_2407     GI: 15888633     BI number: AGR_C_2407     GOG: COG0540     Description: AGR_C_2407p Gene: AGR_C_2404     GI: 15888632     BI number: AGR_C_2404     GOG: COG0044     Description: AGR_C_2404 CC C  G A  A TA TA TA CG |  G |  C |  C |  A        G A  A      C  A AT       T  T GC        AT CG        AT |  A      C  | G  A       GC AT        CG CG        TA AT        GC GC        TG |  G       AT GC        AT TA        GC             ATTATTTCGTTCAGACACTGGATGGCGAACCGAAGGTTTTCGGCTGGGTATCGGGTGACGAGCAGGCGCTCCTGAAGGAACACGGTATTGCCTGAcggtccagaacgatggacaccatctttgccggattgaggaaacagcaccgtgttttcatttcagcggttgcaggcgcTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0540 Aspartate carbamoyltransferase, catalytic chain ... can be seen here [F] COG0044 Dihydroorotase and related cyclic amidohydrolases ... can be seen here     ..................................................................................................................