                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:172 nt.     Distance to run of Ts=3 nt.   Size=30 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -9.90 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-15.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tccacatcaggtggtggattaagcggaatgcgcgcgatggcacgcaaacaaccggtcagactggctgtcgcaggccacgataggtatggatataaggggc
cgcttgcggaagtgtatcgggttttgtcgctgcatcttgccggaaacgtgtctggcattctcgccgccgcggacttaaatcggcctctcccgaaaaatac
tgaaagcggcggcttaatcgtctcaatcgcttcctgtgggcggaattatgcaatatcaccccactatgcaatgccagtataaaacagctagaagcagcgg
ATG

    AGR_C_2410 Gene: AGR_C_2410     GI: 15888635     BI number: AGR_C_2410     GOG: COG1960     Description: AGR_C_2410   a        ga c  g      c  t t  a      a  a gc        cg gt        cg cg        gt cg       g  a a  c       at at        cg        tt cg       g  |      c  g at        cg        gc a  c       ta        cg a  |       gt        cg cg       |  a      g  a gc       |  t      g  a c  a      |  a      g  g a  g      |  a      g  | cg       |  g      a  | gc       |  g       at gc        tg        tg ta        cg        at a  |       gc        ta gc        gc        at cg        tg        gc                         gggttttgtcgctgcatcttgccggaaacgtgtctggcattctcgccgccgcggacttaaatcggcctctcccgaaaaatactgaaagcggcggcttaatcgtctcaatcgcttcctgtgggcggaattatgcaatatcaccccactatgcaatgccagtataaaacagctagaagcagcggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG1960 Acyl-CoA dehydrogenases ... can be seen here     ..................................................................................................................