                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:57 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-10.70 kcal/mol
Anti-antiterminator:   Size=22 nt.     Delta G= -4.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTCTCGCCATAAcgtgtttgcaccgtcgacgctgcgcgacgaaatgccgggcgacagcattgccgccgcccggtcggcttatcgattgtcc
aactcaccccgcaccagttccagcccgcgtgtggtgatgcggtaaggtttgccgccggaagaggctatcgccctcttctgtttcagctttcggaaggtga
ggagatcgaggccgccgaaaatccagccatcgcgcgtataaagcgtgattttctcgattttgcgggtatcgtctcgaacgagttcaattctgccgccctg
ggcgagcagGTG

    AGR_C_2435 --- AGR_C_2436 Gene: AGR_C_2435     GI: 15888646     BI number: AGR_C_2435     GOG: -------     Description: AGR_C_2435p Gene: AGR_C_2436     GI: 15888647     BI number: AGR_C_2436     GOG: COG0456     Description: AGR_C_2436             c           g  c           g  g           a  c            gc            cg            ta           |  a           a  a           g  a            at            gc            gc cg       a  a t  g      g  |        t ta        tg       a  a ta        gc       t  a cg        gc       g  a g  g      a  a       cg at        at        gc cg        gc        cg ta       |  g       gt tg        gc        cg tg        cg        ta                         ttttctcgattttgcgggtatcgtctcgaacgagttcaattctgccgccctgggcgagcagGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0456 Acetyltransferases ... can be seen here     ..................................................................................................................