                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:141 nt.     Distance to run of Ts=1 nt.   Size=35 nt.     Delta G=-27.70 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-10.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGATTGGTGCTGAAGGCTACATGTCGCAGGAAGACATTCTGAAGACGTCGCCGCAGG
CACAGCAGGCCATCACTGGCGGTGGCGGCGGTCTTTATTGAcatcagtcatgacgtttggcgggggcgcg
ggtctttacatccgcgccccccgcatttatttgagctacaagtttcaatgaaggtgaagaaccagcgaaatgcgcaatgaaatcgtgaacgtagtcgatg
aaatcaagcaggccataagcctgctgaggaggcatctttgactgggatcaggcgataagacgactggactggTTG

    AGR_C_2479 --- AGR_C_2481 Gene: AGR_C_2479     GI: 15888668     BI number: AGR_C_2479     GOG: COG1186     Description: AGR_C_2479p Gene: AGR_C_2481     GI: 15888669     BI number: AGR_C_2481     GOG: COG1335     Description: AGR_C_2481 tc g  a at cg        tt ta       t  a a  c      c  c cg        ta At        gt Gt        gc T  t       gc T  g       cg A  g       gc T  c       cg Tg       |  c Tg        gc Cg        gc Tg        gc G  g       gc Gc        gc Cg        cg Gc        gc             atttatttgagctacaagtttcaatgaaggtgaagaaccagcgaaatgcgcaatgaaatcgtgaacgtagtcgatgaaatcaagcaggccataagcctgctgaggaggcatctttgactgggatcaggcgataagacgactggactggTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG1186 Protein chain release factor B ... can be seen here [Q] COG1335 Amidases related to nicotinamidase ... can be seen here     ..................................................................................................................