                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:37 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-16.80 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -6.50 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G= -6.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCGCCGCAAATCGCTCGTCAAGGTGGCCCACGAGTATTCCGAAAAAGCAAAAGTGGC
GATTCGCCATGTGCGCCGGGACGGCATGGACGGCCTGAAAAAAGCCGAAAAAGACGGC
GATATCGGTCAGGACGAAAGCCGTGGACAGTCGGAAAAAGTGCAGAAAATGACCGACG
ACACGATTTCGGAAATTGACCGCTTGCTTGCCGAGAAGGAAAAGGAAATCATGCAGGT
CTGAtatcgctcgcgatagacctgtattttattcgttttaattccgcgctgcctgttactggatcgatATG

    AGR_C_2550 --- AGR_C_2551 --- AGR_C_2553 Gene: AGR_C_2550     GI: 15888704     BI number: AGR_C_2550     GOG: COG0020     Description: AGR_C_2550p Gene: AGR_C_2551     GI: 15888705     BI number: AGR_C_2551     GOG: COG0575     Description: AGR_C_2551p Gene: AGR_C_2553     GI: 15888706     BI number: AGR_C_2553     GOG: COG0750     Description: AGR_C_2553 AC C  G A  A G  T        G C  T      A  G AT       A  A       tc GC       G  A      c  g CG       A  A       gc CG       G  A       cg A  A       CG        ta G  A       CG        at TA       |  A      t  | AT       |  A      A  | AT       |  A      G  | A  G      |  T       Ta A  A       GC        Cg G  C       TA        Ta A  |      T  T       Gc C  |       CG        Gc GC        GC        At TG        TA        Cg GC        TG        Gt AT        CG        Ta AT        GT        At                         tttattcgttttaattccgcgctgcctgttactggatcgatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG0020 Undecaprenyl pyrophosphate synthase ... can be seen here [I] COG0575 CDP-diglyceride synthetase ... can be seen here [M] COG0750 Predicted membrane-associated Zn-dependent proteases 1 ... can be seen here     ..................................................................................................................