                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:175 nt.     Distance to run of Ts=2 nt.   Size=25 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -5.60 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G= -9.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGCGGGGGCGCAGGAAGTGGCGTTCCGTATCGGCATGATGATGATTCTGGGTCTGAT
GGTTTTTGCAACATGGAATGATATCAGCAGCTTGATCGGCTGAggattgtgttttaacggttttgtta
gttatttgtttaccgtgtttttatgccgaagtggcgaatgagccactctggagcacgaagtaaacagaatttaacgttcacgcttgcttgtaggggaaaa
gcaggtaaaacgacgcacatggccggagtcgggttccgcccgctgagggacaacgtaaaaaggtaagaattgaaATG

    AGR_C_2554 Gene: AGR_C_2554     GI: 15888707     BI number: AGR_C_2554     GOG: COG4775     Description: AGR_C_2554 AT C  G G  A GT CG TA AT TG |  A        A |  T      A  C |  T      C  A |  C      G  T GT        TG CG        TG CG        TA TG        TA |  T      |  T T  C      T  G G  T      G  A        A C  G       GT       G  T G  A       TA       T  C GT        AT        TG TG        GC        CG G  G       TA        GC AT        CG        AT AT       |  C       CG GT       |  A      G  A GT        TG       A  g AT        GC        Cg CG        GT        Ta GC        GT        At                         tgtgttttaacggttttgttagttatttgtttaccgtgtttttatgccgaagtggcgaatgagccactctggagcacgaagtaaacagaatttaacgttcacgcttgcttgtaggggaaaagcaggtaaaacgacgcacatggccggagtcgggttccgcccgctgagggacaacgtaaaaaggtaagaattgaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG4775 Outer membrane protein/protective antigen OMA87 ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:187 nt.     Distance to run of Ts=2 nt.   Size=25 nt.     Delta G= -7.90 kcal/mol Antiterminator: Size=42 nt.     Delta G= -5.60 kcal/mol Anti-antiterminator:   Size=31 nt.     Delta G= -3.70 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GTGCGGGGGCGCAGGAAGTGGCGTTCCGTATCGGCATGATGATGATTCTGGGTCTGAT GGTTTTTGCAACATGGAATGATATCAGCAGCTTGATCGGCTGAggattgtgttttaacggttttgtta gttatttgtttaccgtgtttttatgccgaagtggcgaatgagccactctggagcacgaagtaaacagaatttaacgttcacgcttgcttgtaggggaaaa gcaggtaaaacgacgcacatggccggagtcgggttccgcccgctgagggacaacgtaaaaaggtaagaattgaaATG     AGR_C_2554 Gene: AGR_C_2554     GI: 15888707     BI number: AGR_C_2554     GOG: COG4775     Description: AGR_C_2554             T           T  T           T  G           T  C            GA            GA   T        TC A  G       AA G  A      |  T T  T      G  G AT       T  G        A GC        CA       G  T |  T       TA       T  C T  G       GT        TG A  G       GG        CG CG        GA        GC GT        TT        AT GC       |  A       CG |  T      |  T      G  A CG        CC       A  g TA        TA        Cg AT        TG        Ta TG        AC        At                         tgtgttttaacggttttgttagttatttgtttaccgtgtttttatgccgaagtggcgaatgagccactctggagcacgaagtaaacagaatttaacgttcacgcttgcttgtaggggaaaagcaggtaaaacgacgcacatggccggagtcgggttccgcccgctgagggacaacgtaaaaaggtaagaattgaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG4775 Outer membrane protein/protective antigen OMA87 ... can be seen here     ..................................................................................................................