                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:39 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-10.21 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -3.01 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G= -7.31 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cggagagggccatcactctgcgttgcttcggcgcgttcaggccgcttcggctccgaggtcgtgatctgacctggaaactgttcccgcgacaatttcatcg
atcggaatccccgaccggcgtctattcccaacgctacttatatcatcggcctgatctcttcatgtttcgaagattgaatcaggattcgatatgcatcctt
cacgaaattttaggggattgcggaacacatatggaacatatagtgttcgttctgtatttgtttcgcgacttcaacgacgattctcaagggtgttttcctc
ATG

    AGR_C_2577 Gene: AGR_C_2577     GI: 15888721     BI number: AGR_C_2577     GOG: COG1974     Description: AGR_C_2577 ag c  g ta at at gc tg ta at |  a |  t       ag |  g      t  g        t |  c       tg       a  a |  a       tg        tg |  t       ta        at |  c       at        cg gc        at        at at       a  g       at at        gc        gc gc        cg       g  | |  a      a  |      t  | |  c       cg       a  | cg        ta       t  | ta        ta       a  | ta       |  c      c  | ta       |  a      a  | gt       |  c       cg t  t      |  a       at a  t      |  t       at c  t      |  a       gc t  |      |  t       gt ta        cg        cg cg        cg        gt tg        ta        ta                         tttgtttcgcgacttcaacgacgattctcaagggtgttttcctcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [KT] COG1974 SOS-response transcriptional repressors (RecA-mediated autopeptidases) ... can be seen here     ..................................................................................................................