                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:92 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-22.10 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-11.80 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G= -7.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGTCGCGGCAATCGTGGCGCGGGAAGGCGCGCGCGCGGAGGCTGTGGCGCGGGAGCAT
TCCCGCACAGCACGCACCAATCTTGAATACATGATCCGCGAAGCGCCTGAACTGATTG
CGCAGGTTCCGGGTCTCGCACTCATCAGCGACTAAgcggcggaaatcgctgcaaatccaggggtggcgcctttt
ggcgccgcctttatttttgtcgacaccctccctgacgcggtaattttgcgcttgcaatttatcaaagcacagcgtttcatgtatacatagatgcgattgc
cagggaggagATG

    AGR_C_2622 Gene: AGR_C_2622     GI: 15888747     BI number: AGR_C_2622     GOG: COG0404     Description: AGR_C_2622             a           a  a           g  t            gc CA        cg T  T       gc C  C       gt A  A       cg CG        gc GC       |  a CG       |  a       tt TA       |  a      t  t |  C      |  t       cg |  T      |  c       cg |  A      |  c       gc C  A      |  a       cg Tg       A  g       gc Gc       A  g       gc |  g       Tg        tg G  g       Cg        gc Gc        At        gc Cg       G  g       gt Cg        Cg        gt Ta        Gc        at                         atttttgtcgacaccctccctgacgcggtaattttgcgcttgcaatttatcaaagcacagcgtttcatgtatacatagatgcgattgccagggaggagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0404 Glycine cleavage system T protein (aminomethyltransferase) ... can be seen here     ..................................................................................................................