                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:72 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-14.40 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -5.80 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G= -9.42 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCCTGCGCGGGTAAttcgccaggattttgtgggaggtcgttactgcccgtgacgggattggtatcaggcccagcaacacattcgacgtca
tcctcggccttgtgccgaggatctgccaacgtctcctcaatttcgatacgttgcagatgctcgggacaggctctagcatgacgaaggagagtttgacggt
accatcgccaccctaagcccgccctccggcgggctttttcatgccgatctgccgattggaatttaaggtcaacggatagttaaacaatccggcttagtct
cagaatcacgTTG

    AGR_C_2633 Gene: AGR_C_2633     GI: 15888753     BI number: AGR_C_2633     GOG: COG2919     Description: AGR_C_2633   a        ca g  c      c  t t  g      a  c a  a       tg c  a       gc g  g       gc a  g      |  a ta       |  c cg       c  c ta       a  c cg        gt gt        ta gt        ta at        tg cg        gc a  a      |  c       tc g  |      |  c      c  c g  |      |  g       cg gc       |  c       cg cg       a  c       gc t  |       gc        cg cg        at        cg gt        gc        cg ta        gc        gc                         tttttcatgccgatctgccgattggaatttaaggtcaacggatagttaaacaatccggcttagtctcagaatcacgTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [D] COG2919 Septum formation initiator ... can be seen here     ..................................................................................................................