                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:1 nt.     Distance to run of Ts=1 nt.   Size=29 nt.     Delta G=-10.00 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -6.30 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G=-22.74 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCTTGCGGGTAAACTCATGGATATGCGCTTCGGCATCTTCATGAACATCATTCTGGG
CATTGTCGGTTCGGTTGTCGCCGTCGCCGTCCTTCGCACCCTCGATGTCTTTGTGCAG
GACAGCAGGCTCGGTTATTTCGTCACGTCTTTCCTCGGCGCCAGCCTGTTGCTGTTTG
TGGCAAAGCTGGTGCGGCGCTAAcgggccgcatgaccggaaggggcttacgctttttctggaattgttctaaagcatccggcc
aacaggtgtttagatcgctacaggcgatggaagcaggtttttaATG

    AGR_C_2646 Gene: AGR_C_2646     GI: 15888761     BI number: AGR_C_2646     GOG: COG0320     Description: AGR_C_2646 ta t  c cg gc gt gt gt at at gc gt cg cg |  a |  a |  t |  t       ca |  g      c  a |  t      g  c |  t      g  a |  c       cg         c |  t       cg       a  a |  a      t  |      t  g |  a       at        cg |  a       cg        gc a  g      g  |       cg gc        at        ta ta        at        at at        at       g  g c  c       ta       a  g gc        cg        ta cg        ta        ta cg       t  t       tg gc        gc        gc gc        tg        ta                         ggtttttaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0320 Lipoate synthase ... can be seen here     ..................................................................................................................