                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=1 nt.   Size=21 nt.     Delta G=-13.60 kcal/mol
Antiterminator: Size=69 nt.     Delta G=-17.46 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G= -7.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGAGCCACTGAGTGAGCCGATGGACGATTTTTCCAACATCATCAACCTTCTCGAATCC
GCCAAGCAACTCGCATCGATGAACGAAATGCCGATGCTTGCCTATCTCATCGACGTCG
CCAAATGCGAGGCGAGAGAGAACAAGCCGGTTTTGCGAAAGCGCAAACGCGGCGAATC
GACCGTCAAGCAAGACTGTTAAttgccgtttcccataaccgagcgataaagccggctggcccaatcttcaagacgatgtcataa
tcatgcaatgaatccggccgctttttcgaggcggccatttctTTG

    AGR_C_2651 Gene: AGR_C_2651     GI: 15888763     BI number: AGR_C_2651     GOG: COG2207     Description: AGR_C_2651            ca           t  t           g  a            ta            at            gc ta       c  a a  a      a  t g  a      g  g cg       a  c gc       a  a a  |      c  a gc       t  t cg       t  | cg        cg a  c       ta a  |      a  a t  |      a  t at       c  | cg       c  | cg       c  | |  c       gc |  c       gc |  c       tg |  a       cg |  a       gc |  t       gc         t |  c      c  |      t  c |  t       cg        tg |  t       gc        ta |  c       at        tg c  a       at        cg ta        at        gc tg       t  t       cg ta        at        cg gc        gc        gc cg        cg        gc                         atttctTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG2207 AraC-type DNA-binding domain-containing proteins ... can be seen here     ..................................................................................................................