                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:203 nt.     Distance to run of Ts=3 nt.   Size=22 nt.     Delta G= -6.50 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-12.12 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G= -5.09 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGTTCTTCGCGCGGGCGCAACTGCCAGCCGGGCAACCAGAAAATGTCGCGGTCCATG
GAAATATAGCGAAGCCCGAAGGCGGCTGCGAGTTTTTGCGACAGTGTCGATTTTCCAC
CGCCGGAGCAGCCGACGACCATGATGCGGCGTGCCGACGCTATAATCGCAGCGGCATC
CTTGACGTTTTCCAGATAGTTCGGCATcgaataaacctcatcctcgtcgccgtggattatccaataaagcgggcaatatt
ctgcaacggcacgacgccagcgtccgacgttacggaaatttaactaTTG

    AGR_C_2654 Gene: AGR_C_2654     GI: 15888764     BI number: AGR_C_2654     GOG: -------     Description: AGR_C_2654            AT           C  G            CG            TA           |  A           |  A           |  T           |  A           G  T           G  A CA        CG G  A       GC GC        CG GC        TA C  A      G  A G  G      T  | T  A      A  | T  A      A  | a  A      A  | t  A      A  |       GA c  T      G  |      C  A a  G      A  |       CG a  T      C  |       CG t  C      C  |       GC t  G      A  |      A  G t  C      A  |      A  | a  G       CG       G  | a  G       GC        CG aT        GC        GC gC        GC        AT gC        CG        TG                         CGAGTTTTTGCGACAGTGTCGATTTTCCACCGCCGGAGCAGCCGACGACCATGATGCGGCGTGCCGACGCTATAATCGCAGCGGCATCCTTGACGTTTTCCAGATAGTTCGGCATcgaataaacctcatcctcgtcgccgtggattatccaataaagcgggcaatattctgcaacggcacgacgccagcgtccgacgttacggaaatttaactaTTG     ..................................................................................................................