                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:70 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G= -8.20 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -9.61 kcal/mol
Anti-antiterminator:   Size=30 nt.     Delta G= -3.49 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCATCGCCATTTCCGAAAACAGCGACCTGCCGTCCCTCGACCCGGAAGAAAGCGGGG
AAGGTTGAAAGGCGGTCGCCAGCAGCAGAAAAATCATGTTCGTTGTGCATTGGACATA
TATCCCGCATcgcggcacaagattgaagaaacagaaattcaagcctcttcgacacctggatttttatttctcgaacaccccggttttggagga
aaacaaaccggcaaggatttttcgagccttggcggagctttggaatccttcggaatcccttgacaaagcgggtgcccgcgccgaacaaggaATG

    AGR_C_2681 Gene: AGR_C_2681     GI: 15888779     BI number: AGR_C_2681     GOG: COG0590     Description: AGR_C_2681             t           t  c           t  t           a  c           t  g           t  a           t  a       ga           t  c      g  a           t  a      a  a at       a  c      g  a a  t       gc        gc a  c       gc        ta g  a      t  c      t  | a  a       cg        ta c  g       cg        ta a  c       at        gc a  c      c  t       gc at        at        cg gc        gt        cg at        cg       |  c at        tg       |  a gc        ta       |  a tg        cg        cg ta        tg        cg                         atttttcgagccttggcggagctttggaatccttcggaatcccttgacaaagcgggtgcccgcgccgaacaaggaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [FJ] COG0590 Cytosine/adenosine deaminases ... can be seen here     ..................................................................................................................