                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:84 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -7.70 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -9.26 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G=-17.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGGATTTCGTGTTCGATAACATCGAGGAGGCGGGCGGCGAGCGACTGGCTGGTCAAG
GGTCTGATCCTTCGTTCCGCTTTGAGGAAAGCGGTCTTCGCATGGGAAAATCGACAGG
TGATTGTCATtccttgttcggcgcgggcacccgctttgtcaagggattccgaaggattccaaagctccgccaaggctcgaaaaatccttgccg
gtttgttttcctccaaaaccggggtgttcgagaaataaaaatccaggtgtcgaagaggcttgaatttctgtttcttcaatcttgtgccgcgATG

    AGR_C_2683 --- AGR_C_2685 --- AGR_C_2687 --- AGR_C_2689 Gene: AGR_C_2683     GI: 15888780     BI number: AGR_C_2683     GOG: COG0007,COG1648     Description: AGR_C_2683p Gene: AGR_C_2685     GI: 15888781     BI number: AGR_C_2685     GOG: NOG08205     Description: AGR_C_2685p Gene: AGR_C_2687     GI: 15888782     BI number: AGR_C_2687     GOG: COG0155     Description: AGR_C_2687p Gene: AGR_C_2689     GI: 15888783     BI number: AGR_C_2689     GOG: COG3749     Description: AGR_C_2689             a           g  a            cg            cg            ta ca       t  t g  c       at gc        gc gc        gc cg       |  a gc       |  a c  t      |  a       aa gt       |  g      g  a gt       |  c      c  a cg       g  t      t  a t  t      a  c      c  t t  |      a  c       gc gc       c  g       gc ta       t  c       at ta        gc        at cg        ta        cg cg        ta       c  c tg        tg        gc Ta        cg        cg At        gc        cg                         tttgttttcctccaaaaccggggtgttcgagaaataaaaatccaggtgtcgaagaggcttgaatttctgtttcttcaatcttgtgccgcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0007 Uroporphyrinogen-III methylase ... can be seen here [H] COG1648 Siroheme synthase (precorrin-2 oxidase/ferrochelatase domain) ... can be seen here [P] COG0155 Sulfite reductase, beta subunit (hemoprotein) ... can be seen here [S] COG3749 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................