Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:98 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-16.90 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -7.80 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-13.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCTATAGCCGCGAAAAGGGCTGCTTCCCGCCCGGCGCCTTCCGCATCGACAAATACTG
GTCGCCGGTCAACCGCATCGACAATGTCTATGGCGACCGCAACCTGATCTGCACCTGC
CCGCCGATGGAGGCTTATGCCGAGGCCGCAGAATAAggcatcgctgcaaaccaacatgcaaaggcccggagcg
atccgggcctttttcgttacggatagttttgcgaccgcgcagtcgtctctctcacacgattgatctgcacacgttgcatgctaaacagggcgacgcggtt
aaggggatgaaATG

    AGR_C_2697


Gene: AGR_C_2697     GI: 15888787     BI number: AGR_C_2697     GOG: -------     Description: AGR_C_2697


 GC
T  C
A  G
 TA        ca
 TG       c  a
 CG       a  c
 GC       a  a
 GC        at
A  G       cg
G  |       gc
 GC        ta
 TA       c  a
A  G      g  a
G  A      c  g
C  A      t  |
C  T      a  |
G  A       cg
C  A       gc
 Cg        gc
 Cg       A  c       cg
 Gc       A  g      g  a
 Ta       T  g       at
|  t      A  a       gc
|  c      A  |       gc
C  g      G  |       cg
C  c      A  |       cg
 At        Cg        cg
 Cg        Gc        gc
 Gc        Cg        gc
                        tttttcgttacggatagttttgcgaccgcgcagtcgtctctctcacacgattgatctgcacacgttgcatgctaaacagggcgacgcggttaaggggatgaaATG
    ..................................................................................................................