Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:46 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G= -8.30 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -5.80 kcal/mol
Anti-antiterminator:   Size=27 nt.     Delta G= -3.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttttggctgcccttcatcttgcgtgaccataaaagaaaaaagccccgcaaacgggcggggcaggttgatcgctcggggaaagttgggcaatgcccgggag
cgatggcttgatataagtgacaatagtgctgacgcgataggccatttccgtcccaaacagtacgcctatgcataaatttcgctcaatctgcagttttttg
aacgatgagttatgcaaatctgtaagacaacttgacagacttttgctttattctttgcattgcctcgaattgcacatattcgcctttaacataacgtgac
ATG

    AGR_C_2767


Gene: AGR_C_2767     GI: 15888827     BI number: AGR_C_2767     GOG: -------     Description: AGR_C_2767


            t
          a  g
          g  a
           cg
           at
           at
          |  a       ca
          |  t      a  a
          |  g       gc
           gc        at
  a        ta        at
c  g       ta       |  g
g  t       ta        ta
t  t      t  t       gc
c  t      t  |       ta
t  t      t  |       cg
 at        gc        ta
 at        at       |  c
 cg        cg       |  t
 ta        gt        at
c  a      |  a       at
 gc        ta        at
 cg        cg        cg
 ta        ta        gc
                        tttattctttgcattgcctcgaattgcacatattcgcctttaacataacgtgacATG


    ..................................................................................................................