                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:44 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -8.00 kcal/mol
Antiterminator: Size=29 nt.     Delta G= -4.00 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G= -9.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGGGCTTCAACTCCACGCTGACGATGCTCGACGGTCGCGGTGAAGGCGGTGGTGGTC
GCAGCGGTGGCGGCGATTTCGGCGGTGGCAATGATTATGGCAGCGGCGGCGGTTACGA
CCAGCAGTCCTCGCCGCGCGGCGGCTCATCCCGTGGCGGCGGCCAGCCTTCCGGTGGC
TTCTCCAACGATATGGATGACGATATTCCGTTCTGAggctgatactgtcgacactgccgcaagtcagaatttt
gtggttttttcgatgtattgatatcatcatcgggctgacaggagatttgagacATG

    AGR_C_2786 --- AGR_C_2785 Gene: AGR_C_2786     GI: 15888836     BI number: AGR_C_2786     GOG: COG3609     Description: AGR_C_2786p Gene: AGR_C_2785     GI: 15888835     BI number: AGR_C_2785     GOG: COG3668     Description: AGR_C_2785 GA T  C A  G G  A GT TA AT T  T A  C GC CG AT AT         c C  C      a  t C  T      c  g T  |      a  c CG        gc         g TA        cg       a  a Tg       t  |      c  a Cg        gc       t  t Gc        ta        gt Gt       c  a       at |  g      a  |       at |  a       tg        cg |  t       at        gt Ta        gc        cg Gc        ta        cg Gt        cg        gt                         tttttcgatgtattgatatcatcatcgggctgacaggagatttgagacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG3609 Predicted transcriptional regulators containing the CopG/Arc/MetJ DNA-binding domain ... can be seen here [R] COG3668 Plasmid stabilization system protein ... can be seen here     ..................................................................................................................