                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:147 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-10.60 kcal/mol
Antiterminator: Size=31 nt.     Delta G=-14.60 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-13.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCATAAGGCCCGCGGTCCCAGCGCAGGAACGGCGTCAGATAATAAATGCCGAGCGTG
ATCAGCATCACCAGCCATTTGAACCGCCGGAACCGGCCCTCGGCGCGCTTGGGAAAAA
TCTTCTTGCGCGCTTCGTAGAGCGGTTTGCGCGTTTTTGCGGAATTGACGGCTTCCGC
CTCCAGCCTTTCAACGGGCTGTTGCGGGCGATCCTGTCCGGCGCGATAGATGTTCATg
ataggagtccatttttatctccttgctttctcccacctccgcggtgaaacatccttgacttacatcaaGTG

    AGR_C_2823 --- AGR_C_2825 --- AGR_C_2827 Gene: AGR_C_2823     GI: 15888855     BI number: AGR_C_2823     GOG: NOG07404     Description: AGR_C_2823p Gene: AGR_C_2825     GI: 15888856     BI number: AGR_C_2825     GOG: COG3324     Description: AGR_C_2825p Gene: AGR_C_2827     GI: 15888857     BI number: AGR_C_2827     GOG: COG0346     Description: AGR_C_2827 AA G  C GC CG CG GC C  C C  C A  | AT        AA GC       A  T TG       A  C        G TG        AT       A  A T  C       GT       T  G A  G       GC        GC C  C       GT        CG CG       T  T       TG GC       T  |      T  T |  T       CG       C  T AT        GC        GT CG        CG        CG CG        GC        GC A  |       CG        CG CG        GC        GC TA        GT        TG                         TTTTTGCGGAATTGACGGCTTCCGCCTCCAGCCTTTCAACGGGCTGTTGCGGGCGATCCTGTCCGGCGCGATAGATGTTCATgataggagtccatttttatctccttgctttctcccacctccgcggtgaaacatccttgacttacatcaaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3324 Predicted enzyme related to lactoylglutathione lyase ... can be seen here [E] COG0346 Lactoylglutathione lyase and related lyases ... can be seen here     ..................................................................................................................