                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:90 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G= -8.70 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-12.40 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-24.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aggttttgcgtaccggttccgcgtcattttccggcacggccgcccgcgattgacaggatggtctttcgcacatagccttttatcaggaccggtgtttccg
gcatccggggtaatcagggcttttgatgtcccgcatcctgcgggcaggtcttgtttctccgatccggtatcagcggcagtccggcatgagcaaccggggg
acgcctttttctacgaatcgttcccttcatggccgtctgtccctggcttgcgacaccgcaaagatgccggtccgcttcattctttcctttcaggttttcc
ATG

    AGR_C_2839 Gene: AGR_C_2839     GI: 15888864     BI number: AGR_C_2839     GOG: COG2087     Description: AGR_C_2839   c t  c a  t cg gc cg         t cg       a  c cg        gc t  |       cg gc        cg ta       t  t a  |      c  a g  |      t  t t  |      t  | t  |      t  | t  |       gc         a tg        ta       g  g cg        tg       t  c gt       |  c      a  a gc        cg       c  a gt        tg        gc at        gc        gc cg       g  a       cg t  t      a  |       cg a  t       cg        tg a  t       gt       g  g t  |       gc       a  g gc        gc       c  a gt       |  g      g  | gc        cg        gc gc        gc        cg cg        ta        gc                         ctttttctacgaatcgttcccttcatggccgtctgtccctggcttgcgacaccgcaaagatgccggtccgcttcattctttcctttcaggttttccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG2087 Adenosyl cobinamide kinase/adenosyl cobinamide phosphate guanylyltransferase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:146 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-11.40 kcal/mol Antiterminator: Size=47 nt.     Delta G=-12.90 kcal/mol Anti-antiterminator:   Size=51 nt.     Delta G=-12.90 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case aggttttgcgtaccggttccgcgtcattttccggcacggccgcccgcgattgacaggatggtctttcgcacatagccttttatcaggaccggtgtttccg gcatccggggtaatcagggcttttgatgtcccgcatcctgcgggcaggtcttgtttctccgatccggtatcagcggcagtccggcatgagcaaccggggg acgcctttttctacgaatcgttcccttcatggccgtctgtccctggcttgcgacaccgcaaagatgccggtccgcttcattctttcctttcaggttttcc ATG     AGR_C_2839 Gene: AGR_C_2839     GI: 15888864     BI number: AGR_C_2839     GOG: COG2087     Description: AGR_C_2839 ta t  t        c t  c      t  a ta       a  g cg       a  g cg        tg g  a       gc         c a  c       gt       t  c t  c       gt       a  t a  g      g  t       cg cg       c  t       gc at        cg        cg cg        ta        cg gt        at        cg c  t       cg       t  | t  t       gt        gc t  c       gc        ta t  c      c  c      a  | cg       c  c      g  | tg       t  |      t  | g  |      t  |      t  | gc        tg       t  | ta        gc        tg at        ta        cg gc        gt        gt gc        gc        gc                         ttgtttctccgatccggtatcagcggcagtccggcatgagcaaccgggggacgcctttttctacgaatcgttcccttcatggccgtctgtccctggcttgcgacaccgcaaagatgccggtccgcttcattctttcctttcaggttttccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG2087 Adenosyl cobinamide kinase/adenosyl cobinamide phosphate guanylyltransferase ... can be seen here     ..................................................................................................................