                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:40 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-10.00 kcal/mol
Antiterminator: Size=29 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gctccgccgggacaTCAGAATACGGCGAGATATTTCAATAGCGAAATAATGCCGATGATGATGA
CGATCACCTGGGCGATCTGTTTTGCGCCGCCGCCGACCGGCAGTCGCGCGATGAGCCA
CAAGACGAGCACGATCACCAGGAAGGTGATCAGAATGCTGACGAGCGTAGATGTAACC
ATatgtcccagctccctgtaaaataaaggttcaacggtcgttcaccgtcgtgtgaataaaaagcgccagacggttttttgttccatacggttggttgcg
cgcgattaaatttggattctgTTG

    AGR_C_2859 Gene: AGR_C_2859     GI: 15888872     BI number: AGR_C_2859     GOG: COG1765     Description: AGR_C_2859   t         a g  t      t  a c  c      a  a ta       a  a gc       g  a gc        tg cg        gc at        tg |  c       gc |  g      |  c |  t      |  a |  g       cg at        ta cg        gc ta        cg ta        cg gt        at             tttttgttccatacggttggttgcgcgcgattaaatttggattctgTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG1765 Predicted redox protein, regulator of disulfide bond formation ... can be seen here     ..................................................................................................................