                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:106 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -8.80 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-12.00 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-16.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGTTCAAGGACAATAAGCGCGCAGGCGTTCTGGCTACCCATCACCGGGCGCGGCCGCA
CACTGCCAACGACAATATTCGCAGCATGGAATTCGACATGGCCGAGCATGAGCGCAAC
TGGTGTTCGCTCGCTGTCTTCTCGCTGCTGCTGCTGGTCGGCGCTGTGTCGATCGTCA
GCCCGTTTTTCTCGATTTTTTCGGTGTGActccatcaaggcgcgtttttgcttgaaaaacgcgcctttgccatttagcc
cgttctaaccaaggcgcgaaacgcgcgtgacaggatgaagggacaggATG

    AGR_C_2915 Gene: AGR_C_2915     GI: 15888900     BI number: AGR_C_2915     GOG: COG0608     Description: AGR_C_2915   C A  T A  G CG GT CG GT AT GC T  | A  |       GC CG       T  T GC        CG AT        GC GC       C  T C  |      T  G CG       C  C GC       T  T        G G  |       TG       C  A T  |       CG       T  T AT       T  T       GC CG        GC        TG AT        TG       |  T GC        CG        GC C  |       GC        TA T  |       CG        CG T  |      |  C       GC AT       T  T      C  | AT        CG        GC GC        GT        GC GT        CG        CG                         TTTTTCTCGATTTTTTCGGTGTGActccatcaaggcgcgtttttgcttgaaaaacgcgcctttgccatttagcccgttctaaccaaggcgcgaaacgcgcgtgacaggatgaagggacaggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0608 Single-stranded DNA-specific exonuclease ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:114 nt.     Distance to run of Ts=2 nt.   Size=31 nt.     Delta G=-15.10 kcal/mol Antiterminator: Size=32 nt.     Delta G= -9.60 kcal/mol Anti-antiterminator:   Size=53 nt.     Delta G=-16.90 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TGTTCAAGGACAATAAGCGCGCAGGCGTTCTGGCTACCCATCACCGGGCGCGGCCGCA CACTGCCAACGACAATATTCGCAGCATGGAATTCGACATGGCCGAGCATGAGCGCAAC TGGTGTTCGCTCGCTGTCTTCTCGCTGCTGCTGCTGGTCGGCGCTGTGTCGATCGTCA GCCCGTTTTTCTCGATTTTTTCGGTGTGActccatcaaggcgcgtttttgcttgaaaaacgcgcctttgccatttagcc cgttctaaccaaggcgcgaaacgcgcgtgacaggatgaagggacaggATG     AGR_C_2915 Gene: AGR_C_2915     GI: 15888900     BI number: AGR_C_2915     GOG: COG0608     Description: AGR_C_2915   C A  T A  G CG GT CG GT AT GC T  | A  | CG GC AT GC C  |       GC         T CG       T  T      C  G GC        CG       G  T G  |       GC        CG T  |      C  T       GT AT       T  G       GC CG       C  C       CG AT       T  T       TA GC        TG        GT C  |       CG        GC T  |      T  T       TG T  |       GC       C  T AT        TG        GC AT        CG        TA GC        GC        CG GT        CG        GC                         CCGTTTTTCTCGATTTTTTCGGTGTGActccatcaaggcgcgtttttgcttgaaaaacgcgcctttgccatttagcccgttctaaccaaggcgcgaaacgcgcgtgacaggatgaagggacaggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0608 Single-stranded DNA-specific exonuclease ... can be seen here     ..................................................................................................................