                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:147 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-21.90 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -6.00 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-24.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGAAGATGCGATCCGCAAGGCCGTGAAGGCGATCAAGAACGAGAAATATCTCGTCAG
CGAACCGCAGGTCATCCGCATCGAGCGGACCTGAaacgcctgacgatttgtccaaagccgagggccgtgcttccg
tagggatgcgcggccttttttcatcatgaaacctcgcggggatatcaaaaactatttagagggacgatgttacagctgtcataaaatttgaggacatggc
ttcagaaccgctggaatacgacacgattcggccctatggttaatcatgttcaccaagcgagggaggcGTG

    AGR_C_2917 Gene: AGR_C_2917     GI: 15888901     BI number: AGR_C_2917     GOG: -------     Description: AGR_C_2917   C T  G A  A CG GC CG CG TA A  | C  | T  | GC GC         c AT       t  c CG       g  a G  A       ta        ta C  a       ta       g  g C  a      t  g       cg A  |      a  c       cg A  |       gc        ta Gc        cg       t  t Cg       a  a       cg |  c      g  |       gc Gc        tg        tg At        cg        gc Cg        cg        cg Ta       |  c       cg Gc        gc        gc Cg        cg        gc Ta        at        gt                         tttttcatcatgaaacctcgcggggatatcaaaaactatttagagggacgatgttacagctgtcataaaatttgaggacatggcttcagaaccgctggaatacgacacgattcggccctatggttaatcatgttcaccaagcgagggaggcGTG     ..................................................................................................................