                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:30 nt.     Distance to run of Ts=1 nt.   Size=38 nt.     Delta G=-10.60 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -6.30 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G=-17.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCCGCCGACGATCAACTACAACAATCCCGATCCGACCATCACCCTCGACGTGGTGCC
GAATGTGAAGCGGGATGCGCAGGTGGGTGCGGTTCTCTCCAACTCCTTCGGGTTTGGC
GGGCAGAATGCAAGCCTTGTCATGACGCGGGAACCGGCTTAAccggttccgccacaacaggagcgtttc
caaaagcactgcggaaacgctctcgtctctttgattacgcattccagccgcaaaaccgttacagagttttgctggaatgatttttagataacgccctcgg
gcgaaggactgaaatATG

    AGR_C_2931 --- AGR_C_2930 Gene: AGR_C_2931     GI: 15888908     BI number: AGR_C_2931     GOG: COG0604     Description: AGR_C_2931p Gene: AGR_C_2930     GI: 15888907     BI number: AGR_C_2930     GOG: COG1560     Description: AGR_C_2930             t           c  t           t  t        a   c        cg       t  c g  a       ta       t  a a  c       gt       g  g a  t      c  t      c  a a  g      t  a       cg a  c      c  c       at cg       t  |       at cg        cg        at ta        gc        at ta       |  a      c  | ta       |  t      g  | gc       |  t      c  | cg       c  c       cg gc       a  c       gc at       a  a       at gc       a  g       cg g  t       gc        cg a  c       gc        ta cg        cg        ta at        gc        at                         gatttttagataacgccctcgggcgaaggactgaaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [CR] COG0604 NADPH:quinone reductase and related Zn-dependent oxidoreductases ... can be seen here [M] COG1560 Lauroyl/myristoyl acyltransferase ... can be seen here     ..................................................................................................................