                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:175 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -8.00 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-19.00 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-20.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGTTCAGCGAAATTCCGCTCGGTCCCATCGTCAAGAAGCGGGCCGAGGAAGTTGGCCT
GATGGCGGCCATTGCCGCGGACGCGCAGAAATAAgcgcttccgcccgtttcaaaagagggcgttttttccgtcgg
cccggtttcgatgcatgaaaatcgtgggctcgcgacggcggatcgggccttcgccattgccaatccgcatcgcgcgctttattccgcaacgcatgaagtg
gttgttcgcaaccgctgtggatagccgtgaccgtttcggcggggccggctgcaaaggatgacagacgATG

    AGR_C_2935 --- AGR_C_2934 Gene: AGR_C_2935     GI: 15888910     BI number: AGR_C_2935     GOG: COG0304     Description: AGR_C_2935p Gene: AGR_C_2934     GI: 15888909     BI number: AGR_C_2934     GOG: COG0304     Description: AGR_C_2934            AA           A  T           G  A   T       A  A A  G       Cg G  G       Gc T  C       Cg CG        Gc CG       C  t GC        At GC        Gc TA        Gc T  T       Cg G  T       Gc A  G      C  | A  |      C  | GC       G  |        a GC       T  |      c  a A  G      T  |      t  a GC       A  |      t  a CG       C  |      t  g CG       C  |      g  a G  A       Gc        cg G  |       Gc        cg GC        Cg        cg CG        Gt        gc GC        Gt        cg                         ttttttccgtcggcccggtttcgatgcatgaaaatcgtgggctcgcgacggcggatcgggccttcgccattgccaatccgcatcgcgcgctttattccgcaacgcatgaagtggttgttcgcaaccgctgtggatagccgtgaccgtttcggcggggccggctgcaaaggatgacagacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IQ] COG0304 3-oxoacyl-(acyl-carrier-protein) synthase ... can be seen here [IQ] COG0304 3-oxoacyl-(acyl-carrier-protein) synthase ... can be seen here     ..................................................................................................................