                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:54 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-15.30 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -8.00 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G= -5.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TACGCCGGAGAGCCACACGATCGACGATCTGGGCATCGACAGCCTCGACTTTCTCGAT
ATCGTTTTTGCCATCGACAAGGAATTCGGCATCAAGATTCCGCTCGAGCAGTGGACGC
AGGAAGTCAACGAAGGCAAGGTTTCCACCGAAGAATACTTCGTGCTGAAGAACCTCTG
CGCCAAGATCGACGAATTGCGCGCCGCCAAGGGCTGAtctgacaatgcccgcatcgagcgggcatttcttttt
ccggacccggccctgttgggcgggtcgcaaccgaccagagacaggccggaccgATG

    AGR_C_2940 Gene: AGR_C_2940     GI: 15888911     BI number: AGR_C_2940     GOG: COG0764     Description: AGR_C_2940             T           C  G           G  A            Gt            Gc            At           |  g   T       A  a T  G      C  c A  C      C  a A  G      G  a GC       C  t CG        Cg         c A  C       Gc       t  g GC       C  c      a  a CG        Gc        cg T  C       Cg        gc A  C       Gc        cg G  A       Ta        cg A  A      T  |       cg A  G      A  |       gc CG        At        ta CG        Gc        at GC        Cg        at                         tctttttccggacccggccctgttgggcgggtcgcaaccgaccagagacaggccggaccgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG0764 3-hydroxymyristoyl/3-hydroxydecanoyl-(acyl carrier protein) dehydratases ... can be seen here     ..................................................................................................................