                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:127 nt.     Distance to run of Ts=0 nt.   Size=14 nt.     Delta G= -8.30 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -8.10 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-10.36 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCAAAAGCGACCTCAGCTACGCCTTCATGGACAAGACGCGCTTCACCGTCAATGTCGC
CACCGATCCCGCCAATGCCAACCAGTTTACGGTCAAAGTCGAATACGACGCCCGCAAC
CTGCCGATCTGGAGCCTCTATAGCTATACCCTGCCCGAGCCGGTCATCCGGCGTTTTT
CCACCATCCGGATCGGAGGAGCATGAcatgcggaccattccttccctgcttccccgcttcctcaaggataaaacgggcaac
atcgccatttcggccgggctcaccgcgccgctcttcatcggcataTTG

    AGR_C_2962 Gene: AGR_C_2962     GI: 15888922     BI number: AGR_C_2962     GOG: COG4655     Description: AGR_C_2962 AT A  A GC CG         T TA       C  A GC       T  T |  G      C  A |  C       CG |  C       GC |  C       AT |  G      |  A |  C      |  T |  A      |  A A  A      |  C A  C       GC A  C       GC C  T      T  T TG       C  G GC       T  C GC       A  C CG        GC A  A       CG T  T      |  A       CA T  |       CG       T  T T  |       GC        GC GC       T  C       GC AT        CG        CG CG        CG        CG CG        AT        GC                         GTTTTTCCACCATCCGGATCGGAGGAGCATGAcatgcggaccattccttccctgcttccccgcttcctcaaggataaaacgggcaacatcgccatttcggccgggctcaccgcgccgctcttcatcggcataTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4655 Predicted membrane protein ... can be seen here     ..................................................................................................................