                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:146 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-18.80 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-14.50 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-11.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACGGCACGACGCTGCGCGAAGAAGCCGTTGGTGGTGGATACCTCACCAACGAGGAAT
TCGACCAGTATGTGCGCCCCGAAAACATGATCGGCCCGAAGTAAgccggtttggaatttgtgggaat
tgggaacgggccttcgggcccgtttttgtttgcccgattgacagctgggtaatgagaccgggatagggccggaacatcgagatgcaccggcattgacctc
atttggtgtttttacatcttcctcatacactgttcttccgcagaaaatgccacgaccaagcacgagggtgatatcATG

    AGR_C_2981 Gene: AGR_C_2981     GI: 15888930     BI number: AGR_C_2981     GOG: COG0657     Description: AGR_C_2981   A        tg A  G      g  g G  T       tg C  A       ta C  A       ta Cg        at Gc        at Gc       g  g Cg       g  g Tg        tg At        ta Gt        ta T  |       gc At       g  g Cg        cg        tc |  g       cg       t  g A  a       gc        cg A  a      A  |       cg At       A  |       gc At       T  |       gc Gt        Gc        gc Cg        At        cg |  t       At        at Cg        Gc        at Cg        Cg        gt                         ttgtttgcccgattgacagctgggtaatgagaccgggatagggccggaacatcgagatgcaccggcattgacctcatttggtgtttttacatcttcctcatacactgttcttccgcagaaaatgccacgaccaagcacgagggtgatatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG0657 Esterase/lipase ... can be seen here     ..................................................................................................................