                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:96 nt.    Distance to gene:109 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-13.80 kcal/mol
Antiterminator:    Distance from promoter:64 nt. Size=42 nt.     Delta G=-12.60 kcal/mol
Anti-antiterminator:    Distance from promoter:27 nt.    Size=49 nt.     Delta G= -9.02 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: GTGACG-TATCTT. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGACGATAGATGCTGAGTTTGGATATCTTCGCCCGCTGAGCGACCTTGTCCAATGTC
GTCGCTTGAAAACCCAGCTCCGCAAAGAGTTCGCCTGCAGTGTCGACGATCGTTTGAC
CAAGTGCTTCGTTGACGGGCCGGCCGCGCCGGCTCTGACTATTTTCAGTCACCATAAT
TGCAGTCCTTGACAGTATCGTTATTGTGGAATTAGGATACCATGGAGTTTCTGAAATA
AGCAAgccgaagaattaagcgaaacacgagggcgccATG

    AGR_C_2995 Gene: AGR_C_2995     GI: 15888936     BI number: AGR_C_2995     GOG: COG0492     Description: AGR_C_2995 CA G  A C  A CG TA        AC CG       G  C GT        TA AT        TA C  C       TG C  G       GT C  C       CG         G A  C      |  C      C  C A  T      T  T       CG A  G       AT        GC A  |       GC        GC GC        CG        CG TA        AT        CG TG        GT        GC |  T       CG        GT |  G       TA        GC C  T       GC       C  T GC        TG       A  | CG       G  G      G  | TA       A  |       TG GC        CG        TA CG        GC        GC                         TATTTTCAGTCACCATAATTGCAGTCCTTGACAGTATCGTTATTGTGGAATTAGGATACCATGGAGTTTCTGAAATAAGCAAgccgaagaattaagcgaaacacgagggcgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0492 Thioredoxin reductase ... can be seen here     ..................................................................................................................