                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:196 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G= -8.40 kcal/mol
Antiterminator: Size=68 nt.     Delta G=-14.85 kcal/mol
Anti-antiterminator:   Size=27 nt.     Delta G= -6.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aatggcgggacctcagccgcccggcagtcccagtcggcaattgttactgtagacatcgagacaatttacgcgaattcaaaccgggtttcatcccggcttt
ttctttcggttcatgccattggccaattttgacatcctgggtggccaaaagtacttgtgctttgaggttcgtgggttcaagtatcaaagggttacagcgg
gaatggccagtattcggatacattgctcatctgatcatccggatgaacccttgaaaggcggcgccaggcgctgcttttctgttgatgcggagggaacatc
ATG

    AGR_C_3001 Gene: AGR_C_3001     GI: 15888939     BI number: AGR_C_3001     GOG: COG0451     Description: AGR_C_3001            ag           t  a            gc            ta           |  t           |  c           c  g           a  a            tg            ta            gc            ta            ta            at            at           c  t           g  a            gc            cg           t  c           g  g   g       a  a g  c      c  a c  a      c  t ta       c  t gt       t  c at       g  a cg       a  a       tc c  t      c  a      t  a c  t       gc       t  t ta        gc        gc gc        cg        gc at        cg        gc cg        cg        cg gt        gt        cg                         ctttttctttcggttcatgccattggccaattttgacatcctgggtggccaaaagtacttgtgctttgaggttcgtgggttcaagtatcaaagggttacagcgggaatggccagtattcggatacattgctcatctgatcatccggatgaacccttgaaaggcggcgccaggcgctgcttttctgttgatgcggagggaacatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [MG] COG0451 Nucleoside-diphosphate-sugar epimerases ... can be seen here     ..................................................................................................................