Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_circular
Characteristics of the secondary structures
Terminator: Distance to gene:57 nt. Distance to run of Ts=0 nt. Size=35 nt. Delta G=-17.40 kcal/mol
Antiterminator: Size=45 nt. Delta G=-15.42 kcal/mol
Anti-antiterminator: Size=41 nt. Delta G=-15.40 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
cgcgagccagcgttccggcagtgtcggtcgggacactccgggtctgcagggtcgattttcgttatgatgtctcgatatgacggggcgctgatccgcccgg
catcagaaggggatcaggagagggggcgttggtccggcgcggggaggccgccggcggtcaggagatcggtgagatgctcgctggcgagcgcgacgatggc
aagggcggcctgctggcggttccagccggcatgttccgctttttcgatcagcccttgaatggaaggctccagtgcgaattggcactcggcctgatagtcc
ATG
AGR_C_3022
Gene: AGR_C_3022 GI: 15888950 BI number: AGR_C_3022 GOG: ------- Description: AGR_C_3022
g
t t g
g g a c
g a g a
cg c a
ta a g t
at g g t c
| g cg g c
gc gc g a
at | g cg
gc cg gc
| g gc gc
gc a c tg
at gt cg
cg cg gc
tg gc ta
gc g t | t
| g t g | g
g a cg c t
cg gc c t
gc cg gc
| g t | gc
gc cg cg
cg gt gc
tttttcgatcagcccttgaatggaaggctccagtgcgaattggcactcggcctgatagtccATG
..................................................................................................................