                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:98 nt.    Distance to gene:30 nt.     Distance to run of Ts=1 nt.   Size=26 nt.     Delta G=-10.20 kcal/mol
Antiterminator:    Distance from promoter:66 nt. Size=44 nt.     Delta G= -8.30 kcal/mol
Anti-antiterminator:    Distance from promoter:27 nt.    Size=58 nt.     Delta G=-14.41 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgatt-tatctc. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgatttcgttaaacatcctgtgtatctcggatacatggttttgtaagggtccatattgtggaggcaatacccctatacattcagacttctggagggtct
ggccagtctggcaacaatagctatcctgatgtcgcggtcgtggcacggacatcctgttttgccgacacctttgttgcgaaggttgttctGTG

    AGR_L_113 --- AGR_L_115 Gene: AGR_L_113     GI: 15890163     BI number: AGR_L_113     GOG: COG1593,COG3090     Description: AGR_L_113p Gene: AGR_L_115     GI: 15890164     BI number: AGR_L_115     GOG: COG1638     Description: AGR_L_115 ct a  t gc at cg tg ta a  | c  | a  | t  |        a a  |      c  a t  |      a  t c  |      a  a cg        cg cg        gc cg        gt at        ta t  c      c  t a  t      t  c a  g       gc        gt cg        at       c  g gc        cg        tg gc       |  a       gc |  a      |  t      |  a |  g       cg        gc at        gt        cg gc        gc       g  | gt        tg        cg |  g      |  c       ta tg        cg        gc gc        tg        ta ta        gt        at ta        gc        gc                         ctgttttgccgacacctttgttgcgaaggttgttctGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1593 TRAP-type C4-dicarboxylate transport system, large permease component ... can be seen here [G] COG3090 TRAP-type C4-dicarboxylate transport system, small permease component ... can be seen here [G] COG1638 TRAP-type C4-dicarboxylate transport system, periplasmic component ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:146 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -6.60 kcal/mol Antiterminator: Size=61 nt.     Delta G= -5.90 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case gaggtgccgcgatgcaaggtcaccatgagaaatcgagactttatcaatcatgatccactatatggaccttaaacgcgcacgacttaactgcataaatccg tctatttactgttgatttcgttaaacatcctgtgtatctcggatacatggttttgtaagggtccatattgtggaggcaatacccctatacattcagactt ctggagggtctggccagtctggcaacaatagctatcctgatgtcgcggtcgtggcacggacatcctgttttgccgacacctttgttgcgaaggttgttct GTG     AGR_L_113 --- AGR_L_115 Gene: AGR_L_113     GI: 15890163     BI number: AGR_L_113     GOG: COG1593,COG3090     Description: AGR_L_113p Gene: AGR_L_115     GI: 15890164     BI number: AGR_L_115     GOG: COG1638     Description: AGR_L_115 gt c  c c  t ta at at at ta |  c at cg gt |  t |  g |  a |  t |  t |  t t  c cg at at ta ta |  a        c |  c      t  g c  a       cg at        ta gc        at c  c       ta at        gc cg        ta gt        gt cg        tg gt        cg             ttttgtaagggtccatattgtggaggcaatacccctatacattcagacttctggagggtctggccagtctggcaacaatagctatcctgatgtcgcggtcgtggcacggacatcctgttttgccgacacctttgttgcgaaggttgttctGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1593 TRAP-type C4-dicarboxylate transport system, large permease component ... can be seen here [G] COG3090 TRAP-type C4-dicarboxylate transport system, small permease component ... can be seen here [G] COG1638 TRAP-type C4-dicarboxylate transport system, periplasmic component ... can be seen here     ..................................................................................................................