                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:114 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-21.40 kcal/mol
Antiterminator: Size=38 nt.     Delta G=-16.00 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G= -9.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTACAGTCCACccgatacctaagtgtagtttcggcaaggcctggcctgcgataatttctgcctgtcgccccgccccagggcgattggctcgc
agaagccagaaactccggcgtcccctccccggagccgcggatctccctcccgatccgccaaggccgcccccgccgcaggaggcggccttttttttcattt
tggccgcgggaacgcaggcaacctatgcctgagtattatgtttactccttcgcagttgcgttagcgtcatgactatcgtcaatccgcacaatcgaaggaa
cctctgacATG

    AGR_L_213 Gene: AGR_L_213     GI: 15890217     BI number: AGR_L_213     GOG: COG0243     Description: AGR_L_213            ct           c  c           c  c           t  c            cg            ta   c        at        cg t  c       gc       c  c c  c       gc       g  a c  c       cg        cg cg        gc        cg cg       |  c      c  a ta       |  a       cg g  |      |  a       cg cg        cg        gc gc        cg        cg gc        gc        cg cg       |  c       gc c  c      a  g       gc tg        gc        at cg        gc        at                         ttttttcattttggccgcgggaacgcaggcaacctatgcctgagtattatgtttactccttcgcagttgcgttagcgtcatgactatcgtcaatccgcacaatcgaaggaacctctgacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0243 Anaerobic dehydrogenases, typically selenocysteine-containing ... can be seen here     ..................................................................................................................