                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:12 nt.     Distance to run of Ts=3 nt.   Size=19 nt.     Delta G= -6.30 kcal/mol
Antiterminator: Size=36 nt.     Delta G=-15.20 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-14.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGCGCCTGATAATATCGACAAGTCATAAATGGTGGCTTTTTTTGAACTTATGCCCGT
CACtgtgatctccccaactgattccgattattagagcacgcatccccttgacggaagggcgcttcatgatatggttattgcaccatcgattgtgcaga
ttggcaatatcgattgtgcatggtggttgctatgggagtggcaagggagagtctcgaataagcgagatgagagattttgaacgcgtccgggaaaaacggg
ctgcgggcggatttcgtttgccgaatttttgaggaggaacatcaATG

    AGR_L_271 Gene: AGR_L_271     GI: 15890249     BI number: AGR_L_271     GOG: COG1879     Description: AGR_L_271 ta a  a a  g gc cg ta cg ta gt |  g |  a        a a  g      a  a g  a      g  a a  g      g  a g  a       gc gt        cg gt        cg at        tg at        gc cg       |  t        t |  a       cg       a  t g  a       gc       g  t gc        cg        gc tg       a  g       cg gc       a  g       gt a  g       gc        gt g  t       tg        gt gc        tg        cg gc        ta        gc                         cgaatttttgaggaggaacatcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1879 ABC-type sugar transport system, periplasmic component ... can be seen here     ..................................................................................................................