Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear
Characteristics of the secondary structures
Terminator: Distance to gene:95 nt. Distance to run of Ts=2 nt. Size=35 nt. Delta G=-26.80 kcal/mol
Antiterminator: Size=47 nt. Delta G=-12.00 kcal/mol
Anti-antiterminator: Size=50 nt. Delta G=-24.00 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
CCTGCTGTTTCGCCCGCCCGCGCCCTCGGTGGAAGGATCAGGGCTGCGTTTTCCGGCA
ATGCGGCGTTGAATACCGCAGCGGACAACTGGGAGGAGTTCTGAtcctctcccgcgttctgcccttg
cttccggcagggcgctgagggcatcgtttcagacatgaacaccggggatcaggctctgatctccggtgttctgctttttacgctgcgtcggcctggcccg
ccgctgttctttgccttttgcattcacgcccgctaggtttatcgcaactgtctgcaatgcgtctgagggggagccATG
AGR_L_287
Gene: AGR_L_287 GI: 15890256 BI number: AGR_L_287 GOG: ------- Description: AGR_L_287
c ac
g t g a
t t at
t c cg
c c ta
cg ta
cg | c
gc | a
ta t c c
cg gc g t
tg cg gc
tg tg at
gc a g cg
cg c g ta
gc g a at
c t g | gc
c | g | gt
cg at gc
ta gc gc
cg ta cg
tg cg cg
cg g | at
c c cg cg
ta gc at
At gt at
Gc gc gc
tgctttttacgctgcgtcggcctggcccgccgctgttctttgccttttgcattcacgcccgctaggtttatcgcaactgtctgcaatgcgtctgagggggagccATG
..................................................................................................................