                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:155 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-18.30 kcal/mol
Antiterminator: Size=16 nt.     Delta G= -5.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCGCTGGGAAGGCCGCCGGGAATGGCGTGAACGTCAGGCGAGACGGGAATGGCGTGA
ATGGCGCGATCGCCGGGACTACCGCGACCGTCGTGACTACTATCGCTACTGAtgggcaagg
ccctctccaatcgggagggcctttctttatgcgctggtcacccatccatctgtcccccggggagagtgtctacacaacgtcgctaccccgatcgtcatgg
ttcgcgacagatttgcatccgcgtgaggaaaccagggccgtagttcggggttagtcccatatcaccgttcatgaggaggatATG

    AGR_L_313 Gene: AGR_L_313     GI: 15890267     BI number: AGR_L_313     GOG: COG0605     Description: AGR_L_313             a           a  t           c  c            cg   a        tg a  g       cg cg        ta gc        cg gc        cg gc        cg t  |       gc At        gc Gc        at             ttctttatgcgctggtcacccatccatctgtcccccggggagagtgtctacacaacgtcgctaccccgatcgtcatggttcgcgacagatttgcatccgcgtgaggaaaccagggccgtagttcggggttagtcccatatcaccgttcatgaggaggatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0605 Superoxide dismutase ... can be seen here     ..................................................................................................................